PPARG-mediated ferroptosis in dendritic cells limits antitumor
immunity
Leng Han a
, Lulu Bai b
, Chunjing Qu a
, Enyong Dai a
, Jiao Liu c
, Rui Kang d
, Di Zhou a, ***,
Daolin Tang d, *
, Yanan Zhao a, **
a Department of Oncology and Hematology, China-Japan Union Hospital of Jilin University, Changchun, Jilin, 130031, China
b Department of Pediatric Hematology, First Hospital of Jilin University, Changchun, Jilin, 130021, China
c The Third Affiliated Hospital of Guangzhou Medical University, Guangzhou, Guangdong, 510120, China d Department of Surgery, UT Southwestern Medical Center, Dallas, TX, 75390, USA
article info
Article history:
Received 6 August 2021
Received in revised form
25 August 2021
Accepted 28 August 2021
Available online 29 August 2021
Keywords:
Cytokine
Dendritic cells
Ferroptosis
Immunosuppression
Lipid peroxidation
abstract
Dendritic cells (DCs) are antigen-presenting cells of the immune system, which play a key role in anti￾tumor immunity by activating cytotoxic T cells. Here, we report that elevated ferroptosis, a lipid
peroxidation-mediated cell death, impairs the maturation of DCs and their function in tumor suppres￾sion. Ferroptosis is selectively induced in DCs by the GXP4 inhibitor RSL3, but not the SLC7A11 inhibitor
erastin. Ferroptotic DCs lose their ability to secrete pro-inflammatory cytokines (TNF and IL6) and express
MHC class I in response to the maturation signal of lipopolysaccharide. Moreover, ferroptotic DCs fail to
induce CD8þ T cells to produce IFNG/IFNg. Mechanistically, PPARG/PPARg, a nuclear receptor involved in
the regulation of lipid metabolism, is responsible for RSL3-induced ferroptosis in DCs. Consequently, the
genetic depletion of PPARG restores the maturation and function of DCs. Using immunogenic cell death￾based DC vaccine models, we further demonstrate that PPARG-mediated ferroptosis of DCs limits anti￾tumor immunity in mice. Together, these findings demonstrate a novel role of ferroptotic DCs in driving
an immunosuppressive tumor microenvironment.
© 2021 Elsevier Inc. All rights reserved.
1. Introduction
Dendritic cells (DCs) originate from CD34þ hematopoietic stem
cells in the bone marrow and are composed of subpopulations with
different functions in antigen presentation and T-cell activation [1].
Under normal conditions, DCs mainly exist in immature forms,
which are characterized by a strong ability to capture antigen, a low
expression of costimulatory molecules, and a weak ability to
secrete cytokines. However, immature DCs can develop into mature
DCs during the process of infection and tissue damage, leading to
the expression of major histocompatibility complex (MHC) and
costimulatory molecules, increasing cytokine secretion and cell
migration [1]. DC maturation is mainly triggered by pathogen￾associated molecular patterns (PAMPs) produced by microorgan￾isms and damage-associated molecular patterns (DAMPs) driven by
dead or dying host cells [2]. Finally, the mature DCs process the
antigen material and present it to the T cells of the immune system
on the cells’ surface. Cross-priming, the process by which DCs
activate CD8þ T cells by cross-presenting foreign antigens, plays a
key role in generating cytotoxic T-cell immunity against tumors [3].
Ferroptosis is an iron-dependent regulated cell death charac￾terized by unrestricted lipid peroxidation and the rupture of the
plasma membrane and is accompanied by the release of DAMPs [4].
The activation of caspase, a mediator of apoptosis, is not necessary
for ferroptosis [5]. The process and function of non-apoptotic fer￾roptosis are fine-tuned through several antioxidant systems and
membrane repair pathways [6]. Glutathione peroxidase 4 (GPX4)
plays a central role in inhibiting ferroptosis because it can use
Abbreviations: DAMPs, damage-associated molecular patterns; DCs, dendritic
cells; HMGB1, high-mobility group box 1; GPX4, glutathione peroxidase 4; ICD,
immunogenic cell death; IL6, interleukin 6; IFNG, interferon gamma; MDA,
malondialdehyde; MHC, major histocompatibility complex; PAMPs, pathogen￾associated molecular patterns; PPARG, peroxisome proliferator-activated receptor
gamma; PUFAs, polyunsaturated fatty acids; ROS, reactive oxygen species; SLC7A11,
solute carrier family 7 member 11; TNF, tumor necrosis factor.
* Corresponding author.
** Corresponding author.
*** Corresponding author.
E-mail addresses: [email protected] (D. Zhou), daolin.tang@
utsouthwestern.edu (D. Tang), [email protected] (Y. Zhao).
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc

https://doi.org/10.1016/j.bbrc.2021.08.082

0006-291X/© 2021 Elsevier Inc. All rights reserved.
Biochemical and Biophysical Research Communications 576 (2021) 33e39
glutathione or other low molecular weight thiol-containing com￾pounds to effectively reduce hydroperoxides in lipid bilayers and
complex lipoprotein particles [7]. Although GPX4-mediated fer￾roptosis suppression in T cells and B cells is related to impaired
adaptive immunity [8,9], the role of GPX4 inhibition in DCs has not
been determined.
In this study, we provide the first evidence that DCs made sus￾ceptible to ferroptosis by a GPX4 inhibitor exhibit impaired anti￾tumor activities in vitro and in mice. Mechanistically, we
demonstrated that peroxisome proliferator-activated receptor
gamma (PPARG/PPARg), a ligand-activated transcription factor that
determines lipid metabolism in human diseases [10], is essential for
ferroptosis and immune tolerance in DCs. These findings provide
new insights for understanding the impact of ferroptosis on
inflammation and immunity [11].
2. Methods
2.1. Reagents
RSL3 (#S8155), erastin (#S7242), liproxstatin-1 (#S7699), Z￾VAD-FMK (#S7023), oxaliplatin (#S1244), and necrosulfonamide
(#S8251) were purchased from Selleck Chemicals. Dimethyl sulf￾oxide (DMSO) was used to prepare the stock solution of drugs.
DMSO at 0.01% was used as a vehicle control in assays. Lipopoly￾saccharide (LPS) from Escherichia coli O111:B4 was obtained from
Sigma-Aldrich (#297-473-0).
2.2. Cell culture
MEF and DC2.4 cell lines were purchased from the American
Type Culture Collection and Sigma-Aldrich, respectively. KPC cells
were a gift from Dr. David Tuveson. CD8þ T cells were isolated from
the spleen of C57BL/6J mice using a EasySep Mouse CD8þ T Cell
Isolation Kit (#19853, STEMCELL Technologies) according to the
manufacturer’s protocol. These cell lines were grown in Dulbecco’s
Modified Eagle’s Medium or RPMI-1640 with 10% fetal bovine
serum, 2 mM L-glutamine, and 100 U/ml of penicillin and strep￾tomycin. For mixed cell culture, CD8 Tþ cells and DCs were cultured
together at a 1:1 ratio. All cells were mycoplasma-free and
authenticated using short tandem repeat DNA profiling analysis.
2.3. RNAi
The Pparg shRNA-1 (#TRCN0000001657), Pparg shRNA-2
(TRCN0000001660), and control empty shRNA (pLKO.1) were ob￾tained from Sigma-Aldrich. We seeded 1 105 cells in each well of
a 12-well plate in 500 ml of complete medium and then transduced
them by lentiviral vectors at a multiplicity of infection (MOI) of
10:1. Transduction was carried out in the presence of polybrene in
an antibiotic-free medium. After recovering with complete culture
medium, puromycin was used for the selection of transduced cells.
2.4. Cytotoxicity assays
The level of cell death was assayed using a LIVE/DEAD Cell
Viability/Cytotoxicity Assay Kit (#L3224, Thermo Fisher Scientific)
according to the manufacturer’s protocol.
2.5. qPCR analysis
Total RNA was extracted and purified from cultured cells using the
RNeasy Plus Mini Kit (#74136, QIAGEN). First-strand cDNA was syn￾thesized from 1 mg of RNA using the iScript cDNA Synthesis Kit
Fig. 1. RSL3 induces ferroptosis in DCs. (A, B) DC2.4 and MEF cells were treated with erastin (1 mM) or RSL3 (0.5 mM) in the absence or presence of liproxstatin-1 (1 mM), Z-VAD￾FMK (10 mM), necrosulfonamide (1 mM) for 24 h. Cell death was assayed (n ¼ 3 biologically independent samples; *P < 0.05 versus control group). (C) qPCR analysis of Slc7a11 and
Gpx4 mRNA expression in indicated cells (n ¼ 3 biologically independent samples). A MEF group was set up as 1. (DeF) DC2.4 cells were treated with RSL3 (0.5 mM) in the absence or
presence of liproxstatin-1 (1 mM), Z-VAD-FMK (10 mM), necrosulfonamide (1 mM) for 24 h. The levels of intracellular MDA, intracellular C20:4 and C22:4 as well as extracellular
HMGB1 were assayed (n ¼ 3 biologically independent samples; *P < 0.05 versus control group).
L. Han, L. Bai, C. Qu et al. Biochemical and Biophysical Research Communications 576 (2021) 33e39
34
(#1708890, Bio-Rad). The cDNA from various cell samples was then
amplified by real-time quantitative polymerase chain reaction (qPCR)
with predesigned primers (Slc7a11: CTTTGTTGCCCTCTCCTGCTTC and
CAGAGGAGTGTGCTTGTGGACA; Gpx4: CCTCTGCTGCAAGAGCCTCCC
and CTTATCCAGGCAGACCATGTGC; Pparg: GTACTGTCGGTTTCA￾GAAGTGCC and ATCTCCGCCAACAGCTTCTCCT) using a CFX96 Touch
Real-Time PCR Detection System (Bio-Rad).
2.6. Biochemical assay
ELISA assays were performed for the measurement of HMGB1
(#ST51011, Sino-Test Corporation), TNF (#MTA00B, R&D Systems),
IL6 (#M6000B, R&D Systems), IFNG (#MIF00, R&D Systems), and
MDA (#ab118970, Abcam) in indicated samples according to the
manufacturer's instructions.
2.7. Oxidized lipid analysis
Lipids were extracted by the Folch procedure. Oxidized arach￾idonic acid [C20:4] and adrenic acid [C22:4] were assayed using LC￾MS/MS as previous described [12]. The control group was assigned
a value of 1, and the treatment group was then calculated relative to
the control group.
2.8. Flow cytometry
For direct staining, single-cell suspension (1 106 total cells per
staining condition) was washed with cold PBS containing 1% BSA
and incubated with unconjugated IgG for 15 min at 4 C. After
washing, the cells were incubated with MHC class II monoclonal
antibodies (#14-5321-82, eBioscience) in PBS containing 1% BSA.
After washing, the cells were fixed with freshly prepared 1%
methanol-free formaldehyde.
2.9. Animals and treatments
All animal experiments were approved by institutional animal
care and use committees. ICD-based DC vaccine was produced as
previously described [13]. A total of 2 106 KPC cells (C57BL/6J
background), untreated or treated with either oxaliplatin (50 mM,
24 h) or RSL3 (0.5 mM, 3 h), were inoculated subcutaneously in
5 106 indicated DC2.4 cells at 37 C for 90 min. After injecting
200 ml of ICD-based DC vaccine in phosphate buffered saline into
the lower abdomen of female C57BL/6J mice, 5 105 untreated
control cells were inoculated into the contralateral abdomen 7 days
later. The percentage of tumor-free mice was monitored every
week. The aim of this study was not to assess whether there are
sex-differences in the sensitivity of ICD-based DC vaccine.
2.10. Statistical analysis
Statistics were calculated with GraphPad Prism 9.01. ANOVAs
were used for statistical analysis. A P value of less than 0.05 was
considered statistically significant.
Fig. 2. Ferroptosis impairs DC maturation and function. (AeC) Analysis of the release of TNF and IL6 as well as MCH-II expression in DC2.4 cells following treatment with LPS
(10e100 ng/ml) in the absence or presence of RSL3 (0.5 mM) for 3 h (n ¼ 3 biologically independent samples; *P < 0.05 versus LPS alone group). (DeE) DC2.4 cells were treated with
RSL3 for 24 h, and then the surviving cells were collected (ferroptotic DC2.4) and treated with LPS (10e1000 ng/ml) for 3 h. The release of TNF and IL6 were assayed by ELISA (n ¼ 3
biologically independent samples; *P < 0.05 versus wild-type [WT] DC2.4 group). (F) ELISA analysis of IFNG release in indicated co-cultured cells (DC2.4 cells: CD8 T cells ¼ 1:1;
n ¼ 5 biologically independent samples; *P < 0.05).
L. Han, L. Bai, C. Qu et al. Biochemical and Biophysical Research Communications 576 (2021) 33e39
35
3. Results
3.1. Selective induction of ferroptosis in DCs
DC2.4 is a widely used mouse DC cell line (C57BL/6 background)
with phagocytosis and antigen presentation capabilities. Previous
studies have shown that DC2.4 cells undergo apoptosis or nec￾roptosis under different stimuli, thereby affecting their functions in
infection and immunity [14,15]. To determine whether DC2.4 cells
are sensitive to ferroptosis, we used two classic ferroptosis activa￾tors, erastin and RSL3 [16]. Unlike erastin, RSL3 induced significant
cell death in DC2.4 cells (Fig. 1A). This process was inhibited by a
ferroptosis inhibitor (liproxstatin-1), but not an apoptosis inhibitor
(Z-VAD-FMK) or necroptosis inhibitor (necrosulfonamide) (Fig. 1A).
Consistent with previous studies [17], immortalized mouse em￾bryonic fibroblasts (MEFs) were sensitive to the same concentra￾tion of erastin or RSL3 used in DC2.4 cells (Fig. 1B). Since erastin and
RSL3 induce ferroptosis by targeting solute carrier family 7 member
11 (SLC7A11) and GPX4, respectively [5,7], we detected the
expression of Slc7a11 and Gpx4 mRNA in DC2.4 and MEFs.
Compared with MEFs, the mRNA expression of Slc7a11 in
DC2.4 cells was lower (Fig. 1C). In contrast, Gpx4 mRNA expression
was similar in DC2.4 and MEFs (Fig. 1C).
To further confirm that RSL3 induces ferroptosis in DC2.4 cells,
we analyzed lipid peroxidation, a key hallmark of ferroptosis. In
fact, quantitative analysis of malondialdehyde (MDA, an end
product of lipid peroxidation) showed that RSL3 induces lipid
peroxidation in DC2.4 cells (Fig. 1D). Subsequent analysis of
oxidized polyunsaturated fatty acids (PUFAs), such as arachidonic
acid [C20:4] and adrenic acid [C22:4], the main substrate of lipid
peroxidation during ferroptosis, further confirmed the activity of
RSL3 in causing lipid reactive oxygen species (ROS) production in
DC2.4 cells (Fig. 1E). As expected, in DC2.4 cells, RSL3 increased the
release of high-mobility group box 1 (HMGB1) (Fig. 1F), a DAMP
molecule that predicts cell membrane damage in various types of
cell death, including ferroptosis [18]. Of note, lipoxstatin-1, but not
Z-VAD-FMK or necrosulfonamide, reversed the production of MDA,
oxidized PUFAs, and HMGB1 induced by RSL3 in DC2.4 cells
(Fig. 1DeF). Overall, these findings support that DCs can undergo
RSL3-induced ferroptosis.
3.2. Ferroptosis impairs DC maturation and function
The effects of cell death on DC activity are context-dependent.
For example, previous studies have shown that necroptotic DCs
promote T-cell activation [19,20]. To determine the phenotypic ef￾fect of ferroptosis on DCs, we used three models. First, we
compared the ability of DC2.4 cells to secrete pro-inflammatory
cytokines in response to “maturation” signals, such as that of bac￾terial LPS, in the absence or presence of RSL3. Indeed, RSL3 not only
reduced LPS-induced cytokine secretions, such as tumor necrosis
factor (TNF) (Fig. 2A) and interleukin 6 (IL6) (Fig. 2B), but also
limited the LPS-induced expression of MCH-II in DC2.4 cells
(Fig. 2C). Second, we analyzed the ability of DCs that survived RSL3-
induced ferroptosis to produce cytokines. DC2.4 cells that survived
24 h after stimulation with RSL3 also lost the ability to secrete TNF
(Fig. 2D) and IL6 (Fig. 2E) in response to LPS. Third, we compared
the ability of RSL3-treated DC2.4 and RSL3-untreated DC2.4 cells to
activate fresh CD8þ T cells isolated from mouse spleen. Compared
with the untreated group, DC2.4 cells after RSL3 treatment lost the
ability to activate CD8þ T cells to produce interferon gamma (IFNG/
IFNg) (Fig. 2F), a central orchestrator of antitumor immune re￾sponses. Collectively, these data indicate that the maturation and
function of DCs are impaired by ferroptotic stimuli.
Fig. 3. PPARG mediates ferroptosis in DCs. (A) qPCR analysis of Pparg mRNA expression in DC2.4 cells following treatment with RSL3 (0.5 mM) for 3e24 h (n ¼ 3 biologically
independent samples; *P < 0.05 versus untreated group). (B) qPCR analysis of Pparg mRNA expression in indicated Pparg-knockdown DC2.4 cells (n ¼ 3 biologically independent
samples; *P < 0.05 versus control shRNA group). (C) Analysis of cell death in indicated DC2.4 cells following treatment with RSL3 (0.5 mM) for 3e24 h (n ¼ 3 biologically inde￾pendent samples; *P < 0.05 versus control shRNA group). (DeE) Indicated DC2.4 cells were treated with RSL3 for 24 h, and then the surviving cells were collected (ferroptotic DC2.4)
and treated with LPS (10e1000 ng/ml) for 3 h. The release of TNF and IL6 were assayed by ELISA (n ¼ 3 biologically independent samples; *P < 0.05 versus control shRNA group). (F)
ELISA analysis of IFNG release in indicated co-cultured cells (DC2.4 cells: CD8 T cells ¼ 1:1; n ¼ 5 biologically independent samples; *P < 0.05 versus control shRNA group).
L. Han, L. Bai, C. Qu et al. Biochemical and Biophysical Research Communications 576 (2021) 33e39
36
3.3. PPARG drives ferroptosis in DCs
PPARG is a member of the nuclear receptor family that regulates
many cellular processes, including DC maturation and function
[10,21]. To determine whether PPARG is implicated in the modu￾lation of ferroptosis in DCs, we first assayed PPARG expression. A
qPCR analysis showed that RSL3 induced Pparg mRNA upregulation
in a time-dependent manner (Fig. 3A). Next, we used two
lentivirus-mediated Pparg-shRNAs to inhibit PPARG expression in
DC2.4 cells. The qPCR confirmed that Pparg mRNA expression was
suppressed to approximately 90%e95% in Pparg-knockdown
DC2.4 cells (Fig. 3B). Subsequent phenotypic analysis showed that
the suppression of PPARG reduced RSL3-induced death in
DC2.4 cells (Fig. 3C), indicating that PPARG is a positive regulator of
ferroptosis in DCs. Accordingly, RSL3 treated Pparg-knockdown
DC2.4 cells had a restored ability to produce TNF (Fig. 3D) and IL6
(Fig. 3E) in response to LPS. In addition, after RSL3 treatment, Pparg￾knockdown DC2.4 cells had the ability to activate CD8þ T cells to
produce IFNG (Fig. 3F). Thus, PPARG is a key factor that prevents DC
maturation and activation during ferroptosis.
3.4. Ferroptotic DCs exhibit impaired antitumor activities in mice
Immunogenic cell death (ICD) has therapeutic potential by its
releasing of DAMPs to enhance the maturation and antigen uptake
of DCs and subsequent cytotoxic T-cell response [22]. The classic
ICD model is oxaliplatin-induced apoptosis [22]. To evaluate the
role of ferroptosis-susceptible DCs in ICD-initiated adaptive im￾munity, we utilized the following prophylactic tumor vaccination
model. Oxaliplatin-treated pancreatic ductal adenocarcinoma KPC
cells (C57BL/6J background) were injected subcutaneously into the
right flank of immunocompetent female C57BL/6J mice with or
without RSL3-treated control or Pparg-knockdown DC2.4 cells
(Fig. 4A). One week later, the mice were rechallenged with live KPC
cells on the other side. We found that RSL3-treated Pparg-knock￾down DCs can protect mice from tumor challenge better than RSL3-
treated control DCs (Fig. 4B). Since early ferroptotic cancer cells also
have the ability to trigger ICD as a vaccine [23], we further evalu￾ated the effect of RSL3-treated control or Pparg-knockdown
DC2.4 cells on ICD induced by RSL3-treated KPC cells. In the RSL3-
induced ICD model, RSL3-treated Pparg-knockdown DCs protected
mice from tumor attack better than RSL3-treated control DCs
(Fig. 4C). Altogether, these animal studies suggest that PPARG￾mediated ferroptotic DCs lose their antitumor activities, regard￾less the antigen produced from apoptotic or ferroptotic cancer cells.
4. Discussion
Cell death is a basic biological process that affects human health
and disease, in part through the immune response. In this study, we
reported that DCs undergoing ferroptosis lead to immune toler￾ance, which is different from the results of previous studies, namely
that DCs undergoing necroptosis enhance the immune response
[19,20]. Therefore, depending on the form of cell death, DCs may
Fig. 4. Ferroptotic DCs exhibit impaired antitumor activities in mice. (A) KPC cells were treated with oxaliplatin (50 mM, 24 h) or RSL3 (0.5 mM, 3 h) and co-incubated with RSL3-
treated DCs to produce ICD-based DC vaccine. (B) Pparg-knockdown DC2.4 cells enhanced the capacity of oxaliplatin-treated tumor cells to vaccinate against KPC cells in C57BL/6J
mice. The percentage of tumor-free mice is indicated (n ¼ 10 mice/group; *P < 0.05). (C) Pparg-knockdown DC2.4 cells enhanced the capacity of RSL3-treated tumor cells to
vaccinate against KPC cells in C57BL/6J mice. The percentage of tumor-free mice is indicated (n ¼ 10 mice/group; *P < 0.05).
L. Han, L. Bai, C. Qu et al. Biochemical and Biophysical Research Communications 576 (2021) 33e39
37
have opposite immune consequences in the microenvironments of
diseases and therapy.
Historically, ferroptosis has been described as carcinogenic RAS
mutation-dependent cell death [5]. Today, ferroptosis is recognized
as lipid peroxidation-mediated non-apoptotic cell death [24]. This
change reflects the complexity and plasticity of the molecular
mechanism of ferroptosis in disease. Although the GPX4-
dependent pathway plays a major role in preventing ferroptosis,
the GPX4-independent pathway also contributes to inhibiting the
production of lipid ROS [24]. SLC7A11 is the upstream regulator of
GPX4 activity, which produces glutathione. Due to the low
expression of SLC7A11 in DCs, we found that the GPX4 inhibitor
RSL3, but not the SLC7A11 inhibitor erastin, triggers ferroptosis in
DCs. Further identifying SLC7A11-independent glutathione pro￾duction is important for understanding the mechanism of GPX4
activation in DCs.
We have provided direct evidence that ferroptotic DCs exhibit
an impaired ability to produce cytokines, promote MCH expression,
and activate T cells. The maturation and function of DCs in tumor
immunity are regulated at many levels, including by metabolism,
transcription, and degradation mechanisms [3]. We further proved
that PPARG is responsible for RSL3-induced ferroptosis, which leads
to the obstruction of DC maturation. This mechanism is different
from PPARA/PPARa-mediated ferroptosis through lipid remodeling
in cancer cells [25]. It is worth noting that the activation of PPARG
can also induce apoptosis or affect the clearance of apoptotic cells
mediated by macrophages [26,27]. One hypothesis is that different
downstream target genes of PPARG mediate ferroptosis and
apoptosis, respectively. Nevertheless, PPARG-mediated cell death
may be an important mechanism for shaping the immune response
to infection and tissue damage by controlling the number of dead or
dying cells.
We also established a pathological role of ferroptotic DCs in
limiting antitumor immunity. Ferroptosis plays a dual role in tumor
biology and is becoming an attractive target for tumor therapy [28].
On one hand, chronic inflammation caused by ferroptotic damage is
conducive to tumor growth [29]. On the other hand, drug-induced
ferroptosis has shown promising preclinical activity in inhibiting
tumor growth. The advantages and disadvantages of ferroptosis in
tumor treatment also depend on which cells are targeted by fer￾roptosis activators. Similar to a recent study in which ferroptosis in
T cells impaired antitumor immunity [30], we have provided direct
evidence that ferroptosis in DCs can lead to a decline in their an￾tigen presentation ability and subsequent T-cell activation.
In summary, our findings highlight that PPARG-dependent fer￾roptosis in DCs limit antitumor immunity. Since PPARG is mainly
expressed in the immune system and adipose tissue, the combi￾nation of ferroptosis activators and PPARG inhibitors may be an
effective strategy to enhance the antitumor response and reduce
side effects.
Declaration of competing interest
The authors declare no conflicts of interest or financial interests.
Acknowledgments
We thank Dave Primm (Department of Surgery, University of
Texas Southwestern Medical Center) for his critical reading of the
manuscript.
References
[1] I. Mellman, R.M. Steinman, Dendritic cells: specialized and regulated antigen
processing machines, Cell 106 (2001) 255e258.
[2] D. Tang, R. Kang, C.B. Coyne, H.J. Zeh, M.T. Lotze, PAMPs and DAMPs: signal 0s
that spur autophagy and immunity, Immunol. Rev. 249 (2012) 158e175.
[3] S.K. Wculek, F.J. Cueto, A.M. Mujal, I. Melero, M.F. Krummel, D. Sancho, Den￾dritic cells in cancer immunology and immunotherapy, Nat. Rev. Immunol. 20
(2020) 7e24.
[4] D. Tang, G. Kroemer, Ferroptosis, Current Biology 30 (2020) R1eR6.
[5] S.J. Dixon, K.M. Lemberg, M.R. Lamprecht, R. Skouta, E.M. Zaitsev, C.E. Gleason,
D.N. Patel, A.J. Bauer, A.M. Cantley, W.S. Yang, B. Morrison 3rd, B.R. Stockwell,
Ferroptosis: an iron-dependent form of nonapoptotic cell death, Cell 149
(2012) 1060e1072.
[6] X. Chen, J. Li, R. Kang, D.J. Klionsky, D. Tang, Ferroptosis: Machinery and
Regulation, 2020. Autophagy.
[7] W.S. Yang, R. SriRamaratnam, M.E. Welsch, K. Shimada, R. Skouta,
V.S. Viswanathan, J.H. Cheah, P.A. Clemons, A.F. Shamji, C.B. Clish, L.M. Brown,
A.W. Girotti, V.W. Cornish, S.L. Schreiber, B.R. Stockwell, Regulation of fer￾roptotic cancer cell death by GPX4, Cell 156 (2014) 317e331.
[8] M. Matsushita, S. Freigang, C. Schneider, M. Conrad, G.W. Bornkamm, M. Kopf,
T cell lipid peroxidation induces ferroptosis and prevents immunity to
infection, J. Exp. Med. 212 (2015) 555e568.
[9] J. Muri, H. Thut, G.W. Bornkamm, M. Kopf, B1 and marginal zone B cells but
not follicular B2 cells require Gpx4 to prevent lipid peroxidation and ferrop￾tosis, Cell Rep. 29 (2019) 2731e2744, e2734.
[10] M. Ahmadian, J.M. Suh, N. Hah, C. Liddle, A.R. Atkins, M. Downes, R.M. Evans,
PPARgamma signaling and metabolism: the good, the bad and the future, Nat.
Med. 19 (2013) 557e566.
[11] X. Chen, R. Kang, G. Kroemer, D. Tang, Ferroptosis in infection, inflammation,
and immunity, J. Exp. Med. 218 (2021) 1e15.
[12] X. Song, J. Liu, F. Kuang, X. Chen, H.J. Zeh 3rd, R. Kang, G. Kroemer, Y. Xie,
D. Tang, PDK4 dictates metabolic resistance to ferroptosis by suppressing
pyruvate oxidation and fatty acid synthesis, Cell Rep. 34 (2021) 108767.
[13] A.D. Garg, L. Vandenberk, C. Koks, T. Verschuere, L. Boon, S.W. Van Gool,
P. Agostinis, Dendritic cell vaccines based on immunogenic cell death elicit
danger signals and T cell-driven rejection of high-grade glioma, Sci. Transl.
Med. 8 (2016), 328ra327.
[14] L.X. Wang, X.M. Zhu, Y.N. Luo, Y. Wu, N. Dong, Y.L. Tong, Y.M. Yao, Sestrin2
protects dendritic cells against endoplasmic reticulum stress-related
apoptosis induced by high mobility group box-1 protein, Cell Death Dis. 11
(2020) 125.
[15] S.M. Chirieleison, R.A. Marsh, P. Kumar, J.K. Rathkey, G.R. Dubyak, D.W. Abbott,
Nucleotide-binding oligomerization domain (NOD) signaling defects and cell
death susceptibility cannot be uncoupled in X-linked inhibitor of apoptosis
(XIAP)-driven inflammatory disease, J. Biol. Chem. 292 (2017) 9666e9679.
[16] Y. Xie, W. Hou, X. Song, Y. Yu, J. Huang, X. Sun, R. Kang, D. Tang, Ferroptosis:
process and function, Cell Death Differ. 23 (2016) 369e379.
[17] W. Hou, Y. Xie, X. Song, X. Sun, M.T. Lotze, H.J. Zeh 3rd, R. Kang, D. Tang,
Autophagy promotes ferroptosis by degradation of ferritin, Autophagy 12
(2016) 1425e1428.
[18] Q. Wen, J. Liu, R. Kang, B. Zhou, D. Tang, The release and activity of HMGB1 in
ferroptosis, Biochem. Biophys. Res. Commun. 510 (2019) 278e283.
[19] C.C. Collins, K. Bashant, C. Erikson, P.M. Thwe, K.A. Fortner, H. Wang,
C.T. Morita, R.C. Budd, Necroptosis of dendritic cells promotes activation of
gammadelta T cells, J Innate Immun 8 (2016) 479e492.
[20] Z. Zhao, G. Zhang, Y. Sun, A. Winoto, Necroptotic-susceptible dendritic cells
exhibit enhanced antitumor activities in mice, Immun Inflamm Dis 8 (2020)
468e479.
[21] I. Szatmari, E. Rajnavolgyi, L. Nagy, PPARgamma, a lipid-activated transcrip￾tion factor as a regulator of dendritic cell function, Ann. N. Y. Acad. Sci. 1088
(2006) 207e218.
[22] L. Galluzzi, I. Vitale, S. Warren, S. Adjemian, P. Agostinis, A.B. Martinez,
T.A. Chan, G. Coukos, S. Demaria, E. Deutsch, D. Draganov, R.L. Edelson,
S.C. Formenti, J. Fucikova, L. Gabriele, U.S. Gaipl, S.R. Gameiro, A.D. Garg,
E. Golden, J. Han, K.J. Harrington, A. Hemminki, J.W. Hodge, D.M.S. Hossain,
T. Illidge, M. Karin, H.L. Kaufman, O. Kepp, G. Kroemer, J.J. Lasarte, S. Loi,
M.T. Lotze, G. Manic, T. Merghoub, A.A. Melcher, K.L. Mossman, F. Prosper,
O. Rekdal, M. Rescigno, C. Riganti, A. Sistigu, M.J. Smyth, R. Spisek, J. Stagg,
B.E. Strauss, D. Tang, K. Tatsuno, S.W. van Gool, P. Vandenabeele, T. Yamazaki,
D. Zamarin, L. Zitvogel, A. Cesano, F.M. Marincola, Consensus guidelines for
the definition, detection and interpretation of immunogenic cell death,
J Immunother Cancer 8 (2020).
[23] I. Efimova, E. Catanzaro, L. Van der Meeren, V.D. Turubanova, H. Hammad,
T.A. Mishchenko, M.V. Vedunova, C. Fimognari, C. Bachert, F. Coppieters,
S. Lefever, A.G. Skirtach, O. Krysko, D.V. Krysko, Vaccination with early fer￾roptotic cancer cells induces efficient antitumor immunity, J Immunother
Cancer 8 (2020).
[24] D. Tang, X. Chen, R. Kang, G. Kroemer, Ferroptosis: molecular mechanisms and
health implications, Cell Res. 31 (2021) 107e125.
[25] D. Venkatesh, N.A. O’Brien, F. Zandkarimi, D.R. Tong, M.E. Stokes, D.E. Dunn,
E.S. Kengmana, A.T. Aron, A.M. Klein, J.M. Csuka, S.H. Moon, M. Conrad,
C.J. Chang, D.C. Lo, A. D’Alessandro, C. Prives, B.R. Stockwell, MDM2 and
MDMX promote ferroptosis by PPARalpha-mediated lipid remodeling, Genes
Dev. 34 (2020) 526e543.
[26] A.M. Johann, A. von Knethen, D. Lindemann, B. Brune, Recognition of apoptotic
cells by macrophages activates the peroxisome proliferator-activated recep￾tor-gamma and attenuates the oxidative burst, Cell Death Differ. 13 (2006)
1533e1540.
L. Han, L. Bai, C. Qu et al. Biochemical and Biophysical Research Communications 576 (2021) 33e39
38
[27] W.L. Yang, H. Frucht, Activation of the PPAR pathway induces apoptosis and
COX-2 inhibition in HT-29 human colon cancer cells, Carcinogenesis 22 (2001)
1379e1383.
[28] X. Chen, R. Kang, G. Kroemer, D. Tang, Broadening horizons: the role of fer￾roptosis in cancer, Nat. Rev. Clin. Oncol. 18 (2021) 280e296.
[29] E. Dai, L. Han, J. Liu, Y. Xie, H.J. Zeh, R. Kang, L. Bai, D. Tang, Ferroptotic damage
promotes pancreatic tumorigenesis through a TMEM173/STING-dependent
DNA sensor pathway, Nat. Commun. 11 (2020) 6339.
[30] X. Ma, L. Xiao, L. Liu, L. Ye, P. Su, E. Bi, Q. Wang, M. Yang, J. Qian, Q. Yi, CD36-
mediated ferroptosis dampens intratumoral CD8(þ) T cell effector function
and impairs their antitumor ability, Cell Metab. 33 (2021) 1001e1012.
L. Han, L. Bai, C. Qu et al. Biochemical and Biophysical Research Communications 576 (2021) 33e39
39